pcs cg addgene plasmid (Addgene inc)
Addgene inc is a verified supplier 
92
Structured Review
Addgene inc
pcs cg addgene plasmid
Pcs Cg Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbmn+yfp+parkin/pBMN-YFP-Parkin+(Plasmid+%2359416)/pm38354087-192-159-160
Average 92 stars, based on 10 article reviews
Pcs Cg Addgene Plasmid, supplied by Addgene inc, used in various techniques. Bioz Stars score: 92/100, based on 10 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/pbmn+yfp+parkin/pBMN-YFP-Parkin+(Plasmid+%2359416)/pm38354087-192-159-160
Average 92 stars, based on 10 article reviews
pcs cg addgene plasmid - by Bioz Stars,
2026-10
92/100 stars
Images
Related Articles
Transfection:Article Title: A sensitive and quantitative mKeima assay for mitophagy via FACS Article Snippet: Materials: 293T cells (ATCC CRL-3216) DMEM, high glucose (Thermofisher #11960–044 with phenol red or #31053–028) Sodium pyruvate (100 mM) (Thermofisher #11360–070) GlutaMAX (100x) (Thermofisher #35050–061) Fetal bovine serum (FBS), heat inactivated (Sigma F8317–500 ml) DMEM complete media: DMEM media supplemented with 1x GlutaMAX and 1 mM sodium pyruvate and 10% FBS. .. Polyethylenimine, linear, MW 250000, transfection grade (PEI 25K) (Polysciences, 23966–1) Opti-MEM reduced serum medium (Thermofisher 31985062) Article Title: IRGM1 links mitochondrial quality control to autoimmunity. Article Snippet: IFN-γ (BioLegend no. 575306), Torin1 (EMD Millipore no. 475991), Brefeldin A (BD Biosciences no. 555029), MRT-67307 (Sigma no. CAS1190378-57-4), LY294002 (Cayman no. 70920), bafilomycin A1 (Santa Cruz no. sc-201550), E64d (Sigma no. E8640), Pepstatin A (Sigma no. P5318), 3-MA (Sigma no. M9281), MitoTEMPO (Sigma no. SML0737), Oligomycin A (Sigma no. 75351), Antimycin A (Sigma no. A8674) and ethidium bromide (Bio-Rad no. 161-0433) were purchased. .. Plasmids, transduction and transfection. pCHAC-mt-mKeima-IRES-MCS2 was a generous gift from R. Youle (National Institute of Neurological Disorders and Stroke (NINDS)/NIH). pMRX-STING-GFP was a generous gift from N. Yan (University of Texas Southwestern (UTSW)). Plasmid Preparation:Article Title: A sensitive and quantitative mKeima assay for mitophagy via FACS Article Snippet: Materials: 293T cells (ATCC CRL-3216) DMEM, high glucose (Thermofisher #11960–044 with phenol red or #31053–028) Sodium pyruvate (100 mM) (Thermofisher #11360–070) GlutaMAX (100x) (Thermofisher #35050–061) Fetal bovine serum (FBS), heat inactivated (Sigma F8317–500 ml) DMEM complete media: DMEM media supplemented with 1x GlutaMAX and 1 mM sodium pyruvate and 10% FBS. .. Polyethylenimine, linear, MW 250000, transfection grade (PEI 25K) (Polysciences, 23966–1) Opti-MEM reduced serum medium (Thermofisher 31985062) Article Title: Proline restores mitochondrial function and reverses aging hallmarks in senescent cells. Article Snippet: Briefly shRNA sequence targeting PRKAA1 (shAMPKa_1: 50-30 ATGATGTCAGATGGTGAATTT) and PARK2 (shParkin_1: 50-30 GGATCAGCAGAGCATTGTTCA) were designed using the Invitrogen Block-iT RNAi Designer (Thermo Fisher Scientific) and cloned into the pLKO.1-puro lentiviral vector (Addgene plasmid # 8453).83 To ensure specific gene knockdown, a second shRNA lentiviral vector for PRKAA1 (shAMPKa_2; catalog no. pLKO.1shAMPKa1-TRCN0000000861) and for PARK2 (shParkin_2; catalog no. pLKO.1shPARK2-TRCN0000000285) were procured from Sigma-Aldrich. .. To overexpress Parkin, the coding sequence of PARK2 was extracted from Cell Culture:Article Title: A sensitive and quantitative mKeima assay for mitophagy via FACS Article Snippet: Materials: 293T cells (ATCC CRL-3216) DMEM, high glucose (Thermofisher #11960–044 with phenol red or #31053–028) Sodium pyruvate (100 mM) (Thermofisher #11360–070) GlutaMAX (100x) (Thermofisher #35050–061) Fetal bovine serum (FBS), heat inactivated (Sigma F8317–500 ml) DMEM complete media: DMEM media supplemented with 1x GlutaMAX and 1 mM sodium pyruvate and 10% FBS. .. Polyethylenimine, linear, MW 250000, transfection grade (PEI 25K) (Polysciences, 23966–1) Opti-MEM reduced serum medium (Thermofisher 31985062) Protein Binding:Article Title: A sensitive and quantitative mKeima assay for mitophagy via FACS Article Snippet: Materials: 293T cells (ATCC CRL-3216) DMEM, high glucose (Thermofisher #11960–044 with phenol red or #31053–028) Sodium pyruvate (100 mM) (Thermofisher #11360–070) GlutaMAX (100x) (Thermofisher #35050–061) Fetal bovine serum (FBS), heat inactivated (Sigma F8317–500 ml) DMEM complete media: DMEM media supplemented with 1x GlutaMAX and 1 mM sodium pyruvate and 10% FBS. .. Polyethylenimine, linear, MW 250000, transfection grade (PEI 25K) (Polysciences, 23966–1) Opti-MEM reduced serum medium (Thermofisher 31985062) Sequencing:Article Title: Proline restores mitochondrial function and reverses aging hallmarks in senescent cells. Article Snippet: Briefly shRNA sequence targeting PRKAA1 (shAMPKa_1: 50-30 ATGATGTCAGATGGTGAATTT) and PARK2 (shParkin_1: 50-30 GGATCAGCAGAGCATTGTTCA) were designed using the Invitrogen Block-iT RNAi Designer (Thermo Fisher Scientific) and cloned into the pLKO.1-puro lentiviral vector (Addgene plasmid # 8453).83 To ensure specific gene knockdown, a second shRNA lentiviral vector for PRKAA1 (shAMPKa_2; catalog no. pLKO.1shAMPKa1-TRCN0000000861) and for PARK2 (shParkin_2; catalog no. pLKO.1shPARK2-TRCN0000000285) were procured from Sigma-Aldrich. .. To overexpress Parkin, the coding sequence of PARK2 was extracted from Clone Assay:Article Title: Proline restores mitochondrial function and reverses aging hallmarks in senescent cells. Article Snippet: Briefly shRNA sequence targeting PRKAA1 (shAMPKa_1: 50-30 ATGATGTCAGATGGTGAATTT) and PARK2 (shParkin_1: 50-30 GGATCAGCAGAGCATTGTTCA) were designed using the Invitrogen Block-iT RNAi Designer (Thermo Fisher Scientific) and cloned into the pLKO.1-puro lentiviral vector (Addgene plasmid # 8453).83 To ensure specific gene knockdown, a second shRNA lentiviral vector for PRKAA1 (shAMPKa_2; catalog no. pLKO.1shAMPKa1-TRCN0000000861) and for PARK2 (shParkin_2; catalog no. pLKO.1shPARK2-TRCN0000000285) were procured from Sigma-Aldrich. .. To overexpress Parkin, the coding sequence of PARK2 was extracted from Transduction:Article Title: IRGM1 links mitochondrial quality control to autoimmunity. Article Snippet: IFN-γ (BioLegend no. 575306), Torin1 (EMD Millipore no. 475991), Brefeldin A (BD Biosciences no. 555029), MRT-67307 (Sigma no. CAS1190378-57-4), LY294002 (Cayman no. 70920), bafilomycin A1 (Santa Cruz no. sc-201550), E64d (Sigma no. E8640), Pepstatin A (Sigma no. P5318), 3-MA (Sigma no. M9281), MitoTEMPO (Sigma no. SML0737), Oligomycin A (Sigma no. 75351), Antimycin A (Sigma no. A8674) and ethidium bromide (Bio-Rad no. 161-0433) were purchased. .. Plasmids, transduction and transfection. pCHAC-mt-mKeima-IRES-MCS2 was a generous gift from R. Youle (National Institute of Neurological Disorders and Stroke (NINDS)/NIH). pMRX-STING-GFP was a generous gift from N. Yan (University of Texas Southwestern (UTSW)). |